Primer3 Input -version 0.4.0- Info

PRIMER_PICK_LEFT_INPUT=200 PRIMER_PICK_RIGHT_INPUT=400 PRIMER_PRODUCT_SIZE_RANGE=150-250 Version 0.4.0 respects standard thermodynamic calculations (nearest-neighbor).

PRIMER_INTERNAL_OPT_SIZE=20 PRIMER_INTERNAL_MIN_SIZE=18 PRIMER_INTERNAL_MAX_SIZE=30 PRIMER_INTERNAL_OPT_TM=65.0 # Probe Tm should be 5-8°C higher than primers PRIMER_INTERNAL_MIN_TM=63.0 PRIMER_INTERNAL_MAX_TM=68.0 Here is a real-world input for amplifying a 200 bp region from a bacterial 16S rRNA gene: primer3 input -version 0.4.0-

PRIMER_SEQUENCE_ID=my_amplicon SEQUENCE=ATCGGCTAGCTAGCTCGATCGATCGATCGATGCGCTAGC PRIMER_TASK=pick_detection_primers = While many parameters are inherited from earlier versions, version 0.4.0 introduced refined control over mispriming libraries and output formatting. 1. Defining Your Sequence You must provide the target sequence. Use SEQUENCE for the template. For internal oligos (e.g., hybridization probes), use SEQUENCE_INTERNAL . Defining Your Sequence You must provide the target sequence

PRIMER_MISPRIMING_LIBRARY=/path/to/human_repeat_masked.lib PRIMER_MAX_MISPRIMING=12.00 # Maximum allowed mispriming score PRIMER_MAX_END_MISPRIMING=6.00 # Max mispriming score in last 5 bases : The mispriming scoring is more stringent. For highly repetitive targets, increase PRIMER_MAX_MISPRIMING to 15.0 . 6. Product Size Control PRIMER_PRODUCT_SIZE_RANGE=100-300 PRIMER_PRODUCT_OPT_SIZE=200 7. Internal Oligo (Probe) Parameters If PRIMER_TASK=pick_detection_primers , you can specify probe constraints. PRIMER_MISPRIMING_LIBRARY=/path/to/human_repeat_masked